مقاومت مینوز گوجه‌فرنگی، Tuta absoluta (Meyrick) به کلرانترانیلی‌پرول و اثر آن روی هم‌افزایی و مقاومت متقاطع به حشره کش های رایج

نوع مقاله : مقاله کامل، انگلیسی

نویسندگان

1 PG و مرکز تحقیقات بیوتکنولوژی، کالج MGR، موسسه تحقیقات آموزشی آدهیاماآن، هسور 635 130، تامیل نادو، هند

2 گروه حشره‌شناسی، دانشکده علوم کشاورزی و محیط زیست، دانشگاه جورجیا، گریفین، جورجیا، ۳۰۲۲۳، ایالات متحده آمریکا.

3 بخش جانورشناسی، کالج جمال محمد (خودمختار)، تیروچیراپالی-۶۲۰ ۰۲۰، تامیل نادو، هند

4 گروه بیوتکنولوژی، کالج هنر و علوم PSG، کویمباتور - 64104، تامیل نادو، هند.

5 مجموعه ADRC و مرکز تشخیص و تحقیقات اشوانث، تامیل نادو، هند.

6 دپارتمان علوم کشاورزی، دانشکده علوم زیستی، دانشگاه چونگ‌کینگ، چونگ‌کینگ ۴۰۰۷۱۵، چین

چکیده

Tuta absoluta is an invasive polyphagous pest recently reported on tomato, brinjal, and potato in India. It has acquired resistance to many chemical insecticides under field control. A toxicity test demonstrated a 31.7-fold reduction in mortality with high resistance to chlorantraniliprole selection in laboratory circumstances. The cross-resistance profile to various pesticides revealed moderate to high resistance to flubendiamide (2.3-fold) succeeded by spinosad, chlorpyrifos, cypermethrin, imidacloprid, and esfenvalerate (RR=6.0, 3.3, 3.1 and 2.8-fold). No resistance was detected to emamectin and abamectin (RR= 0.9-fold). The synergism bioassay utilizing PBO (piperonyl butoxide), DEM (diethyl-maleate) and TPP (triphenyl phosphate) revealed the potential mechanisms of esterase and P450 metabolic resistance to chlorantraniliprole in T. absoluta. Furthermore, six cytochrome P450 genes (CYP321A7, CYP321A9, CYP6B6, CYP6B47, CYP4M21 and CYP4C71) exhibited higher expressed level in the TN-R G7 resistant population compared to the susceptible one (SS).  This work may facilitate the effective treatment of T. absoluta resistance to chlorantraniliprole through rotation with emamectin and abamectin.
Article Info:
Recieved: 27 May 2025 
Accepted: 07 September 2025 
Published: 06 October 2025
Subject Editor: Jahangir Khajeali
Corresponding Author: Ranganathan Muthusamy and Nagendiran Madhdi
E-mail: rmuthusamy.dr@gmail.com; bioscitecsol@gmail.com
DOI : https://doi.org/10.22034/jesi.45.4.2

چکیده تصویری

مقاومت مینوز گوجه‌فرنگی، Tuta absoluta (Meyrick) به کلرانترانیلی‌پرول و اثر آن روی هم‌افزایی و مقاومت متقاطع به حشره کش های رایج

کلیدواژه‌ها

موضوعات


Introduction

Tuta absoluta is a polyphagous pest from the Gelechiidae family, usually referred to as the South American tomato pinworm. Due to its high reproductive potential and extensive host range, it has invaded many countries, including Europe, Africa, Western Asia, and Central America (Biondi et al., 2018). Recently it has affected numerous regions of India resulting in a total decline of 80-90% in tomato production (El Aimani et al., 2021; Prasannakumar et al., 2021). During a T. absoluta outbreak, it consumed nearly all portions of the plant, ultimately resulting in bacterial and fungal proliferation (Shahini et al., 2021). The management of this pest has depended on the use of chemical insecticides, resulting in a significant escalation in insecticide application. Excessive use of insecticides and pesticides can lead to soil and water contamination (Narayanan and Ma, 2024) and ultimately impact human health, resulting in various types of cancers (Mohan et al., 2024; Rajinikanth et al., 2024) and metabolic disorders (Mani et al., 2024). Due to the continual and recurrent use of synthetic insecticides, T. absoluta has developed resistance to these chemical insecticides (Ong'onge et al., 2023; Narayanan & Prabhu, 2025).

Insects can acquire resistance to chemical pesticides via several mechanisms, including metabolic enzyme resistance, changed target site insensitivity due to particular mutations, and penetration and behavioral resistance. Notably, excessive protein production due to the elevated expression of one or more metabolic enzymes has been shown (Ye et al., 2022). Numerous bioactive compounds obtained from plants (Parveen et al., 2025b) and marine algae (Narayanan & Rajinikanth, 2025) exhibit considerable pest management and medicinal potential (Mani et al., 2024; Narayanan, 2024). It is essential to address insect resistance through an integrated resistance management approach that incorporates the rotation of insecticides with varying modes of action and the application of specific enzyme synergists with insecticides (Kadry et al., 2025; Yin et al., 2019).

Chlorantraniliprole is a novel diamide and member of the 28th group of insecticides, functioning as a ryanodine receptor modulator (Kim et al., 2025). It induces paralysis in insect muscles by triggering the uncontrolled release of internally held calcium ions (Ca2+), ultimately leading to the insect's demise (Lai & Su, 2011; Radhakrishnan & Narayanan, 2025). It serves as a crucial instrument in integrated pest management (IPM) because of its minimal toxicity to mammals and beneficial creatures, and no cross-resistance has been documented with other insecticides (Campos et al., 2014). In recent decades, findings indicate that lepidopteran insects have evolved resistance to chlorantraniliprole insecticide (He et al., 2019). This work examined the potential mechanisms of chlorantraniliprole resistance in T. absoluta, both with and without synergist combinations, as well as its cross-resistance patterns to different insecticides. The expression levels of cytochrome P450 resistance genes were analyzed using qRT-PCR.

Materials and methods

Insect culture

absoluta susceptible populations (SS) were received from ICAR (Indian Institute of Horticulture Research), Crop Protection Division, Bangalore, Karnataka, India. This population was initially collected from a tomato field in Bangalore and preserved in insectariums for 12 generations without exposure to any chemicals. The chlorantraniliprole-resistant (TN-R G7) strain was derived from field-collected populations in Hosur, Tamil Nadu, India. First-generation (F1) larvae derived from field populations were subjected to chlorantraniliprole selection with six different concentrations (ranging from 0.1-10ppm). The LC50 determined for each generation was based on the probit response of the previous generation bioassay. Approximately 300 to 700 larvae were used for each generation. Both the susceptible (SS) and resistant (TN-R G7) T. absoluta were maintained in the insect rearing room at controlled temperature (26±1°C) with relative humidity of 70±5˚C and 12:12 light and dark photoperiod conditions.

Insecticides and chemicals

The chemical and bio-insecticides used in this study were commercially formulated. Chlorantraniliprole 18.5% SC (DuPont), indoxacarb 14.5% SC (Syngenta), flubendiamide 39.35% SC (Bayer Crop Science), fipronil 5% SC (Bayer crop Science), cypermethrin 25% EC (Syngenta), imidacloprid 30.5% SC (Syngenta), esfenvalerate 10% SC (Bayer Crop Science), chlorpyrifos 50% EC (Syngenta), methomyl 35% SC (Syngenta), chlorfluazuron 5.4% EC (Bayer Crop Science), spinosad 45% SC (Dow Agro Science),  emamectin 5% SG and abamectin 5% SG (Syngenta). These chemical insecticides affect the nerve and muscular function of several insect groups classified under IRAC major groups 1, 2, 3, 5, and 6. The synergists PBO, DEM, TPP and other compounds were procured from Himedia chemicals.

Toxicity bioassay

During the 2nd instar, T. absoluta larvae were used for the leaf dip toxicity bioassay Chlorantraniliprole was prepared in ppm concentration with six dosages in distilled water. Uniformly sized (6×6 cm in diameter) healthy, fresh and young tomato leaves were submerged in insecticide solutions for 15 seconds and subsequently air-dried for 20 minutes at 26-28˚C. Moistened cotton pieces were placed in a bioassay container during each treatment to preserve the freshness of the leaves. Leaves immersed solely in deionized water served as controls. Larvae were deemed deceased when they failed to respond to physical perturbation, with mortality reported at 48 hours post-treatment.

Chlorantraniliprole synergism

Synergism bioassays were conducted using 2nd instar larvae from both susceptible and resistant populations of chlorantraniliprole, employing the insecticide chlorantraniliprole in conjunction with PBO, DEM, and TPP to identify potential metabolic pathways associated with resistance. The bioassay method utilized in the synergism investigation resembled the IRAC approach; however, all larvae were topically administered 0.5µl of 15mM of each synergist one hour prior to exposure to chlorantraniliprole. All experiments were conducted in triplicate to reduce error.

Cross-resistance pattern

To detect the potential range of chlorantraniliprole cross-resistance, 2nd instar larvae were subjected to concentration mortality bioassays utilizing indoxacarb, fipronil, cypermethrin, imidacloprid, chlorpyrifos, esfenvalerate, methomyl, chlorfluazuron, spinosad, abamectin, emamectin, and flubendiamide. The bioassay approach employed was that previously delineated for leaf dip bioassay (Muthusamy et al., 2024).

Detoxification inhibitory study

Enzyme preparation

Approximately, thirty early 3rd instars, both resistant and susceptible larvae, were subjected to starvation at 7 hours under cold conditions. Homogenates of larvae were prepared in 50ml of pre-chilled buffer saline (PBS, pH-7.0) with 1mM of each Ethylenediaminetetraacetic acid (EDTA), 1-4-dithiotheritol (DTT), phenyl-thiourea (PTU), and phenyl methyl-sulfonyl-fluoride (PMSF). The extract was separated by centrifugation at 15,000×g for 30 minutes at 4˚C. The finished sample was refrigerated until it was utilized for enzyme activity analysis. Protein quantification was performed with a standard substrate (Bovine Serum Albumin) in accordance with the standard Lowry method.

Detoxification enzyme assay

Esterase activity

The esterase activity was measured according to the methodology of Lokeshwari et al. (2016). The overall reaction volume of 6.0ml comprises 990 µl of phosphate-buffered saline (40 mM, pH 6.8), 10 µl of resistant and susceptible enzyme sample (with and without synergist), and 4000µl of 30mM α-naphthyl acetate diluted in 1ml acetone solvent. The reaction mixtures were gently agitated and incubated at 37°C for 15 minutes in the absence of light. Finally, 1.0 ml of staining solution (1% fast blue BB salt and 5% SDS) was added, and the dark color changes were measured calorimetrically at 590nm. The specific activity of esterase was calculated using standard values of α-naphthyl acetate and expressed as μmole/min/mg of protein.

Glutathione S-transferase activity

The GST activity was quantified using the conjugation of CDNB according to the method of Kao et al. (Kao et al., 1989). The total volume of the reaction tube was 3ml, comprising 0.05ml of 2,4 dichloronitrobenzene (50mM), 0.01ml of enzyme extracts, 0.15ml of GSH (glutathione reduced form), and 2.79ml of 100mM buffer saline (PBS, pH-6.0). The reaction tubes were placed on ice for 5 minutes and the enzyme activities were measured at 340nm and expressed as μmole/min/mg of protein.

Mixed-function oxidase activity

MFO activity was measured according to Fouad et al. (2022) with slight modifications (Fouad et al., 2022). 500 µl of 2 mM pnitroanisole with 450 µL enzyme stock solutions from resistant and susceptible populations were added to the reaction tube and mixed. After incubation for 2 min at 27°C, 50 µL of 9.6 mM NADPH was added to initiate the reaction. The activity of MFO was measured immediately at 405nm for 15 min and expressed as μmole/min/mg of protein. A standard curve of p-nitrophenol was used to calculate MFO activity.

P450s mRNA expression

The mRNA expression of nine resistant cytochrome P450 genes (CYP3, CYP4, and CYP6) was examined in laboratory-selected T. absoluta. Total RNA was isolated from third-instar larvae of each population utilizing the QIAwave RNA Mini Kit (Qiagen, India) in accordance with the manufacturer's instructions. M–MLV reverse transcriptase (Promega, India) was employed to synthesize the first strand of cDNA. The gene-specific primers employed in this study were derived from prior literature (Table 1). The qRT-PCR analysis was performed according to the procedure outlined in our prior study (Muthusamy & Shivakumar, 2015). Using EF-1α as a housekeeping gene, the relative gene expression levels in resistant and susceptible strains were quantified using the 2-ΔΔCT method. 

 Statistical analysis

The LC50, together with its confidence interval and chi-square (χ2) values, was calculated by probit analysis using SPSS statistical software package. All percentage mortality data were corrected using Abbott’s formula. Resistant ratios (RR) from the larval bioassay were calculated by dividing the resistant population lethal value by the susceptible population lethal value. Synergism ratios (SR) were elucidated by dividing the insecticide lethal value alone, and the insecticide synergist combination. The data produced from enzyme activity was evaluated using the Bonferroni multiple comparison post-hoc test, whereas gene expression was assessed by column statistics. Notable discrepancies in enzyme activity and gene expression were deemed significant at p<0.05 using PRISM-Graph Pad (Version 5.0).

Results

Resistance selection

The chlorantraniliprole resistance assay indicated an LC50 value of 7.03 ppm for the field-collected F1 population. After seven generations of in-vitro selection (TN-R), a concentration of 36.54 ppm was observed, corresponding to a resistance ratio of 31.7-fold relative to the laboratory (SS) population, and a 5.19-fold resistance ratio was noted versus the unselected field population, respectively (Table 2).

Synergism of chlorantraniliprole

The synergism ratios of PBO, DEM, and TPP against resistant populations were 2.87, 1.16, and 3.19ppm (*P<0.05), while lower synergism ratios were found in susceptible populations at 1.3, 1.2, and 1.0ppm (Table 3). The synergistic effect of PBO and TPP exceeded that of the susceptible strain, indicating a potential involvement of metabolic enzymes in chlorantraniliprole resistance.

 

Table 1. qRT-PCR primers used in this study

Genes Accession number

Primer sequences (F/R) (5ˈ-3ˈ)

Amplicons Length (bp)

EF-1α

GACAAACGTACCATCGAGAAG

 279

(U20129)

GATACCAGCCTCGAACTCAC

 

CYP321A7

AAAACAACCCCAAGACCCGT

 101

(KC789750.1)

TGAGTTCGTTCCAATGCCGA

 

CYP321A9

GACCCAGAAGTGTTCGACCC

125

(KC789752.1)

TGCACTTGTAGCTTGGCGTA

 

CYP321B1

TACGGAGGGAAGCTGACGTA

125

(KC789754.1)

ACAGAGTCTTCCACGCACTG

 

CYP6AE43

TGCCTTCGGAGTGGAGTCTA

127

(KJ671575.1)

TGGCCATGCAGCTCTACAAA

 

CYP6B6 (Ortholog)

TTGAAGAAAGGCGTATGAAA

232

(KM577332)

ACACGCAAGATACACAAAGG

 

CYP6B47

ACTTCACCTTGTCTCCTTATCCGA

245

(GQ465039.2)

AAAGCTGTCCATGTTTCTCCATC

 

CYP4M21

TGAGCAGACGCGCGATGT

149

(EU189049)

CACCATATCCTCGGAGCTGC

 

CYP4C71

CCGCCACCCATTCGCCTATG

329

(JX876506.1)

CTTCACCTTCACGCCACTCTCC

 

CYP4G74

CCCGGACCTGCCATTATACC

121

  (KC789745.1)

ACACTCTGACTACGTTGCCG

 

 

 

 

Table 2. Toxicity of chlorantraniliprole against field and susceptible population of T. absoluta

Population

  LC50 (95% CI ppm) *

 Slope (±SE)

   Df

       χ2

RR on (F1)   RR on (F7)

Field (F1)

    7.03 (6.24-8.73)

2.84 (0.21)

   3

1.30

      -                  6.1

TN-R G7

    36.54 (35.93-37.48)

3.24 (0.32)

3

  2.12

   5.19              31.7

SS

1.15 (0.37-2.42)

1.38 (1.22)

3

1.11

       -                 -

LC50, lethal concentration that kills 50% of the test animal; ppm, parts per million; CI, confidence interval; χ2, chi-square; RR, Resistant ratio; df, degree of freedom done by probit analysis.

 

 

 

Chlorantraniliprole cross-resistance pattern

 The concentration mortality test for twelve different insecticides targeting field-evolved resistant populations and susceptible populations was conducted to identify potential cross-resistance. The increased LC50 obtained for cypermethrin, chlorpyrifos, and esfenvalerate insecticides were 10.53, 15.44, and 13.42 ppm. Among tested insecticides, only the abamectin and emamectin showed less cross-resistance (RR-0.9), whereas higher resistance was observed for cypermethrin (3.3-fold), chlorpyrifos (6.0-fold), and spinosad (6.0-fold) Table 4.

The activity of detoxification enzymes

The activities of esterase, glutathione S-transferase, and mixed-function oxidase were assessed in the chlorantraniliprole-resistant and susceptible populations following seven generations of selection to discover the enzymes implicated in potential resistance to chlorantraniliprole. Esterase activity was elevated in the resistant field (25µmole/mg protein/min) population compared to susceptible population 11µmole/mg protein/min (Fig. 1). Similarly, GST activity in the resistant group was slightly increased (20µmole/mg protein/min) as compared to susceptible one 10µmole/mg protein/min (Fig. 2) with no significant differences in the enzyme activity (1.0 and 1.5-fold). Next, MFO activity was significantly higher in the 3rd instar larvae from the TN-R G7 population (31µmole/mg protein/min) than the (SS) susceptible population (10 µmole/mg protein/min), which is 2.5-fold increased activity P<0.001 (Fig. 3). This indicates the possible role of P450 conferring chlorantraniliprole resistance in the TN-R G7 population.

 

Fig. 1. Esterase activity in resistant and susceptible populations of T. absoluta. The bar represents the mean, standard deviation (±SD) of enzyme value. Asterisk* shows increased activity in resistant populations compared to susceptible (*P<0.05).

 

Fig. 2. Glutathione S-transferase activity in resistant and susceptible populations of T. absoluta. The bar represents the mean, standard deviation (±SD) of enzyme value. Asterisk* shows increased activity in resistant populations compared to susceptible ones (*P<0.05).

 

Fig. 3. Mixed function oxidase activity in resistant and susceptible populations of T. absoluta. The bar represents the mean, standard deviation (±SD) of enzyme value. Asterisks** show increased activity in resistant populations compared to the susceptible (*P<0.001).

 

 Table 3. Toxicity of chlorantraniliprole in combination with different synergists against resistant and susceptible T. absoluta

Populations

      Treatments

  LC50 (95% CI ppm)*

Slope (±SE)

 χ2

  SR

TN-R G7

Chlorantraniliprole

36.54 (35.93-37.48)

1.43 (0.43)

0.31

-

 

Chlorantraniliprole + PBO

  12.73 (11.06-13.94)

2.42 (0.53)

1.32

2.87

 

Chlorantraniliprole + DEM

  31.32 (30.38-32.93)

1.43 (0.26)

2.12

1.16

 

Chlorantraniliprole + TPP

  11.43 (10.58-12.49)

1.33 (0.73)

0.43

  3.19*

SS

Chlorantraniliprole

   1.15 (0.37-2.42)

 2.31(1.31)

1.64

-

 

Chlorantraniliprole + PBO

   0.84 (0.21-0.98)

1.42 (0.48)

1.53

1.36

 

Chlorantraniliprole + DEM

   0.92 (0.44-1.31)

1.31 (0.21)

0.43

1.25

 

Chlorantraniliprole + TPP

   0.68 (0.22-0.87)

1.11 (0.32)

1.32

1.03

LC50, lethal concentration that kills 50% of the test animal; ppm, parts per million; CI, confidence interval; χ2, chi-square; SR, Synergism ratio; * Indicates significant in synergism ratio between field and susceptible population (Tukey’s multiple range test at P < 0.05).

 

 

Expression profile of Cytochrome P450 genes

The expression levels of nine cytochrome P450 genes exhibited substantial differences between the resistant and susceptible populations (Fig.4). The expression levels of CYP321A9 and CYP6B6 were significantly elevated in TN-R (4.4 and 5.6-fold), followed by CYP321A7 (3.2-fold), CYP6B47 (5.1-fold), CYP4M21 (2.3-fold), and CYP4C71 (2.0-fold), as illustrated in Fig.4.

Discussion

Insecticide resistance poses a significant challenge in newly invasive pest species such as T. absoluta. The persistent and recurrent use of pesticides in agricultural management has resulted in the development of resistance and may induce cross-resistance to other classes of insecticides (Domínguez et al., 2019). Consequently, meticulous assessment of insecticide resistance and its cross-resistance to other insecticides is an important tool for monitoring the resistance and integrated management program (Kadry et al., 2025; Narayanan, 2025; Tarusikirwa et al., 2020). This research focused on the toxicity of broad-spectrum diamide insecticide against the field-collected resistance population of T. absoluta under in-vitro conditions.

 

 

Fig. 4. Relative gene expression level of selected P450s in resistant and susceptible populations of T. absoluta (column statistics *P < 0.05). The error bars represent the standard deviation (n = 3).

 

Table 4. Cross-resistance to selective insecticides in chlorantraniliprole-resistant and susceptible strains

Strains

 Insecticides

        LC50 (95% CI ppm)*

Slope (±SE)          df

   χ2

  RR

TN-R G7

Indoxacarb

2.42 (1.31-3.62)

1.31 (0.32)        4

2.11

1.0

 

Fipronil

4.53 (3.24-5.63)

2.42 (0.24)        3

1.31

1.5

 

Cypermethrin

   10.53 (8.94-11.24)

1.53 (0.66)        3

3.13

3.3

 

Imidacloprid

  3.53 (2.42-4.57)

0.53 (0.44)        4

2.11

3.1

 

Chlorpyrifos

   15.44 (14.53-13.53)

0.78 (0.14)        3

1.52

6.0

 

Esfenvalerate

   13.42 (12.44-14.09)

1.39 (1.40)        3

2.24

2.8

 

Methomyl

4.65 (3.12-5.93)

0.94 (0.21)        3

1.56

1.8

 

Chlorfluazuron

2.43 (1.31-3.45)

2.53 (1.53)        3

2.53

1.2

 

Spinosad

2.54 (1.43-3.53)

1.55 (0.27)        3

3.42

6.0

 

Abamectin

1.11 (0.42-1.93)

2.75 (0.64)        3

1.53

0.9

 

Emamectin

1.49 (0.38-2.10)

1.77 (0.23)        3

2.42

0.9

 

Flubendiamide

3.92 (2.01-4.29)

1.34 (0.13)        3

1.13

2.3

SS

Indoxacarb

2.41 (1.31-3.56)

1.66 (0.65)        4

1.64

-

 

Fipronil

2.92 (1.21-3.85)

2.55 (1.01)        3

2.64

-

 

Cypermethrin

3.15 (2.64-4.55)

2.74 (0.13)        3

2.53

-

 

Imidacloprid

1.13 (0.25-2.40)

1.79 (0.22)        4

1.66

-

 

Chlorpyrifos

2.57 (1.65-3.74)

2.99 (1.50)        3

2.75

-

 

Esfenvalerate

4.64 (3.53-5.32)

1.30 (0.52)        3

1.86

-

 

Methomyl

2.54 (1.31-3.23)

1.45 (0.87)        3

3.54

-

 

Chlorfluazuron

1.93 (0.23-2.14)

2.09 (1.39)        3

2.66

-

 

Spinosad

0.42 (0.13-1.31)

1.62 (0.66)        3

1.86

-

 

Abamectin

1.13 (0.42-2.43)

0.69 (0.96)        3

3.56

-

 

Emamectin

1.53 (0.8-2.24)

1.43 (0.34)        3

2.22

-

 

Flubendiamide

1.64 (0.42-2.53)

2.21 (1.79)        3

1.44

-

LC50, lethal concentration that kills 50% of the test animal; ppm, parts per million; CI, confidence interval; χ2, chi-square; RR, Resistant ratio; df, degree of freedom done by probit analysis.

 

 

 

 

 

 

 

 

 

O

Our findings demonstrated significant resistance to chlorantraniliprole selection in field field-evolved population (RR 31.7-fold) relative to the susceptible group. Comparabl investigations indicated a resistance ratio of 14-fold for chlorantraniliprole and 11-fold for flubendiamide in several field populations of T. absoluta (Parveen et al., 2025a; Roditakis et al., 2015). Subsequently, field control failure was reported in the Italian and Greek populations of T. absoluta, followed by the Israeli population (> 64-fold and 22,573-fold) (Roditakis et al., 2018). Zhang et al. (2025) also reported 24.66-fold resistance in the Chinese field population of Tuta absoluta upon chlorantraniliprole treatment (Vijayakumarr et al., 2025; Zhang et al., 2025). The emergence of elevated resistance levels in these field populations to chlorantraniliprole may result from intensified selection pressure in natural environments relative to laboratory conditions, as well as the heterogeneous composition of the population.

The possibility of cross-resistance to multiple pesticides is a significant challenge in restricting the available options for pest management. The current study indicates that the cross-resistance in chlorantraniliprole-selected T. absoluta seems limited to abamectin and emamectin (a GABA-gated chloride channel allosteric modulators) and moderate to high cross-resistance to flubendiamide (a ryanodine receptors activator) 2.3-fold, followed by spinosad, chlorpyrifos, cypermethrin, imidacloprid, and esfenvalerate (6.0, 3.3, 3.1, and 2.8), which primarily affect sodium channels and target nicotinic acetylcholine receptors. This result indicated that pesticides with analogous modes of action exhibit cross-resistance, while others contribute minimally. Silva et al. (2016) reported analogous findings in Brazilian populations with a resistance ratio ranging from 1.0 to 288,995-fold between cyantraniliprole and flubendiamide insecticides (Silva et al., 2016). Campos et al. (2014) reported limited cross-resistance in spinosad-selected T. absoluta to the similar classes of insecticide (Campos et al., 2014). Venkatesan et al., (2022) documented minimal cross-resistance to buprofezin, pyriproxyfen, and spinosad in Chrysoperla carnea under acetamiprid selection study and also reported very low cross-resistance to abamectin and emamectin (0.9-fold) in T. absoluta under diamide selection (Venkatesan et al., 2022). Ismail (2021) reported that emamectin benzoate was found to be effective against the lepidopteran pest Agrotis ipsilon, which can be used as an alternative to the conventional insecticide for field control (Ismail, 2021).

Esterase, P450, and, to some lesser extent, GST have been reported to be involved in the metabolic resistance to organophosphate, carbamate, pyrethroid, and newer classes of insecticides in many insect species (Bosch-Serra et al., 2021; Muthusamy et al., 2013; Ye et al., 2022). Chlorantraniliprole is a broad-spectrum insecticide utilized for the management of several insect species, particularly in the field control of T. absoluta; nevertheless, the metabolic enzymes and resistance mechanisms present in the Indian field population of T. absoluta remain inadequately understood (Ramkumar et al., 2023). The findings of the current investigation indicated elevated activity of esterase, glutathione S-transferase, and mixed-function oxidase in the chlorantraniliprole-resistant (TN-R) group relative to the laboratory susceptible (SS) population. This finding correlated with the results of PBO and TPP synergist bioassay on chlorantraniliprole resistance T. absoluta, suggesting the possible mechanism of P450 and, to some lesser extent, esterase metabolic enzymes in diamide resistance. The synergism by PBO and TPP in resistance to T. absoluta may lead to the inhibition of P450 and esterase enzymes involved in the rendering of toxic chemicals into less toxic by phase I and II detoxification process by hydrolysis or oxidation of these enzymes (Esteves et al., 2021). Ma et al. (2024) reported diamide resistance in the WZ field population than susceptible reference strain YN-S (Ma et al., 2024). Sun et al. (2018) published similar findings, indicating a 38.8-fold resistance ratio in the chlorantraniliprole laboratory resistant strain (R1) of Chilo suppressalis (Sun et al., 2018). The potential mechanism of deltamethrin resistance in Cimex lectularius L. (common bed bug) is linked to esterase and GST metabolic resistance, enhanced by PBO and DEM synergism (Gonzalez-Morales & Romero, 2019). Gong et al. (2021) reported increased activity of CarE, GST, and P450 in M. dirhodum aphids subjected to imidacloprid pesticide, with a 20-fold PBO synergistic effect (Gong et al., 2021).

The analysis of the cytP450 resistance gene in the TN-R population revealed elevated mRNA expression relative to the susceptible group. Out of nine cytP450 genes, CYP321A9, CYP6B6, CYP321A7, and CYP6B47 showed high expression by chlorantraniliprole selection. Ullah et al. (2025) also reported increased expression of cytochrome P450 mRNA level of CYP321C40, followed by CYP4M116, CYP6AW1, CYP339A1, and CYP6AB327 in the SpRS T. absoluta (Ullah et al., 2025). Earlier studies by Shi et al. (2018) found that members of the CYP6AE subfamily may efficiently transform fenvalerate into 4ˈ-hydroxy fenvalerate (Shi et al., 2018). Elevated expression levels of the detoxifying genes CYP6FU1 and CYP439A1v3 in L. striatellus are correlated with resistance to deltamethrin. Similarly, the overexpression of multiple P450 enzymes has been linked to pyrethroid resistance in H. armigera, Ae. aegypti, and Ae. Albopictus (Wan et al., 2021; Xiao et al., 2020; Zhao et al., 2021). Hafeez et al. (2022) also documented the upregulation of P450 genes in indoxacarb resistance S. frugiperda (Hafeez et al., 2022). Yang et al. (2021) reported a high level of permethrin resistance in Cx. quinquefasciatus mosquitoes (Yang et al., 2021). The prior work by Matowo et al. (2022) indicated that CYP6M2, CYP6Z3, CYP6P3, CYP6P4, CYP6AA1, and CYP9K1 exhibited elevated expression in pyrethroid-resistant Anopheles gambiae (Matowo et al., 2022).

Conclusion

The current study's data indicate a potential for chlorantraniliprole resistance in T. absoluta under laboratory selection. In vitro synergism with PBO and TPP demonstrated the role of esterase and P450-mediated metabolic resistance, while the overexpression of nine P450 genes suggested their involvement in chlorantraniliprole resistance.  Moreover, there exists a moderate to low likelihood of cross-resistance to other kinds of insecticides, with no cross-resistance detected to emamectin and abamectin insecticides.  This information will facilitate the efficient management of diamide resistance in T. absoluta.

Abbreviations

CytP450s: CytochromeP450s; BSA: Bovine serum albumin; PBO: piperonyl butoxide; DEM :diethyl maleate;  TPP: triphenyl phosphate; MFO: mixed function oxidase; IRAC: insecticide resistance action committee; °C: degree Celsius; RH: Relative Humidity; GSH: reduced glutathione; DTNB: 5, 5-dithio-bis-2-nitrobenzoic acid; NADPH: Reduced nicotinamide adenine dinucleotide phosphate; CDNB-GSH: 1-Chloro-2, 4-dinitrobenzene-glutathione; ppm: parts per million; µmole: micromole; mg: milligram; SC: Suspension concentrate; U/ml: Unit per milli liter;  M: Molar; mM: Milli molar; Fig: Figure; GST: Glutathione S-transferase; H2O2: Hydrogen peroxide; KCl: Potassium chloride; LC50: Lethal concentration, 50%; P<: Probability value; pH: Potential of hydrogen; PTU: Phenylthiourea; TMBZ: Tetramethyl benzidine; UV: Ultraviolet rays.

Author's Contributions

Muthusamy R: Conceptualization, Investigation, Writing-original draft. Ramkumar G: Investigation, data analysis. R.Ranjani: Editing manuscript and data analysis. J. Senthil Kumar: Reviewing and editing manuscript. Suguna Kasirajan: Reviewing and editing manuscript.  Madhi Nagendiran: Supervision, writing, editing, and reviewing the manuscript.

Author's Information

Ranganathan Muthusamy

* rmuthusamy.dr@gmail.com

https://orcid.org/ 0000-0002-2650-9791

Govindaraju Ramkumar

*   ayvidram@gmail.com

https://orcid.org/0000-0001-7262-8428

Ranjani Rajendran

*  rranjaniphd@gmail.com

https://orcid.org/0009-0005-2156-7238

Jeyaraj Senthil Kumar

*   senthil.btjeyaraj@gmail.com

https://orcid.org/0000-0002-2272-6414

Suguna Kasirajan

*  suguna6299@gmail.com

https://orcid.org/0009-0006-1650-0538

Nagendiran Madhi

*  bioscitecsol@gmail.com

https://orcid.org/0000-0002-9866-8397

Funding

Not applicable

Data Availability Statement

The detailed methodology and analytical data of the present findings are available from the corresponding author on reasonable request. The methodology and result details of the current study are available from the corresponding author on reasonable request.

Acknowledgments

We thank our PG and Research Department of Biotechnology for providing the support and infrastructure facility.

Ethics Approval

Insects were used in this study. All applicable international, national, and institutional guidelines for the care and use of animals were followed. This article does not contain any studies with human participants performed by any of the authors.

Conflict of Interest

The authors declare no conflict of interest.

Generative AI statement

The authors declare that no Gen AI was used in the creation of this manuscript.

REFERENCES

Biondi, A., Guedes, R. N. C., Wan, F. H. & Desneux, N. (2018) Ecology, worldwide spread, and management of the invasive South American tomato pinworm, Tuta absoluta: past, present, and future. Annual Review of Entomology, 63, 239-258. https://doi: 10.1146/annurev-ento-031616-034933

Bosch-Serra, D., Rodríguez, M. A., Avilla, J., Sarasúa, M. J. & Miarnau, X. (2021) Esterase, glutathione s-transferase and NADPH-cytochrome p450 reductase activity evaluation in Cacopsylla pyri l. (Hemiptera: psyllidae) individual adults. Insects, 12(4), 329. https://doi.org/10.3390/insects12040329

Campos, M. R., Rodrigues, A. R. S., Silva, W. M., Silva, T. B. M., Silva, V. R. F., Guedes, R. N. C. & Siqueira, H. A. A. (2014) Spinosad and the tomato borer Tuta absoluta: a bioinsecticide, an invasive pest threat, and high insecticide resistance. PloS one, 9(8), e103235. https://doi.org/10.1371/journal.pone.0103235

Domínguez, A., López, S., Bernabé, A., Guerrero, Á. & Quero, C. (2019) Influence of age, host plant and mating status in pheromone production and new insights on perception plasticity in Tuta absoluta. Insects, 10(8), 256. https://doi.org/10.3390/insects10080256

El Aimani, A., Mokrini, F., Houari, A., Laasli, S. E., Sbaghi, M., Mentag, R., Iraqi, D., Udupa, M.S., Dababat, A.A. & Lahlali, R. (2021) Potential of indigenous entomopathogenic nematodes for controlling tomato leaf miner, Tuta absoluta (Meyrick)(Lepidoptera: Gelechiidae) under laboratory and field conditions in Morocco. Physiological and Molecular Plant Pathology, 116, 101710. https://doi.org/10.1016/j.pmpp.2021.101710

Esteves, F., Rueff, J. & Kranendonk, M. (2021) The central role of cytochrome P450 in xenobiotic metabolism—a brief review on a fascinating enzyme family. Journal of Xenobiotics, 11(3), 94-114. https://doi.org/10.3390/jox11030007

Fouad, E. A., Ahmed, F. S. & Moustafa, M. A. (2022) Monitoring and biochemical impact of insecticides resistance on field populations of Spodoptera littoralis (Boisd.)(Lepidoptera: Noctuidae) in Egypt. Polish Journal of Entomology, 91(3), 109-118. https://doi.org/10.5604/01.3001.0015.9707.

Gong, P., Chen, D., Wang, C., Li, M., Li, X., Zhang, Y., Li, X. & Zhu, X. (2021) Susceptibility of four species of aphids in wheat to seven insecticides and its relationship to detoxifying enzymes. Frontiers in Physiology, 11, 623612. https://doi.org/10.3389/fphys.2020.623612

Gonzalez-Morales, M. A. & Romero, A. (2019) Effect of synergists on deltamethrin resistance in the common bed bug (Hemiptera: Cimicidae). Journal of Economic Entomology, 112(2), 786-791. https://doi.org/10.1093/jee/toy376

Hafeez, M., Li, X., Ullah, F., Zhang, Z., Zhang, J., Huang, J., Fernández-Grandon GM, Khan MM, Siddiqui, JA., Chen, L. & Ren X.Y. (2022) Down-regulation of P450 genes enhances susceptibility to indoxacarb and alters physiology and development of fall armyworm, Spodoptera frugipreda (Lepidoptera: Noctuidae). Frontiers in Physiology, 13, 884447. https://doi.org/10.3389/fphys.2022.884447

He, F., Sun, S., Tan, H., Sun, X., Qin, C., Ji, S., Li, X., Zhang, J. & Jiang, X. (2019) Chlorantraniliprole against the black cutworm Agrotis ipsilon (Lepidoptera: Noctuidae): From biochemical/physiological to demographic responses. Scientific reports, 9(1), 10328. https://doi.org/10.1038/s41598-019-46915-0

Ismail, S. M. (2021) Field persistence of certain new insecticides and their efficacy against black cutworm, Agrotis ipsilon (Hufnagel). Bulletin of the National Research Centre, 45(1), 17. https://doi.org/10.1186/s42269-020-00481-y

Kadry, S., Madhav, B., Narayanan, M. & Rajinikanth, V. (2025) Automatic farm insects detection using individual/fused efficientnet features. In International Conference on Data Engineering and Communication Technology (pp. 151-159). Singapore: Springer Nature Singapore. https://doi.org/10.1007/978-981-96-5223-5_13

Kadry, S., Prudhvi, M. N., Narayanan, M. & Rajinikanth, V. (2025). Automatic desert/mountain detection from satellite image using deep transfer learning. In International Conference on Data Engineering and Communication Technology (pp. 161-169). Singapore: Springer Nature Singapore. https://doi.org/10.1007/978-981-96-5223-5_14

Kao, C. H., Hung, C. F. & Sun, C. N. (1989) Parathion and methyl parathion resistance in diamondback moth (Lepidoptera: Plutellidae) larvae. Journal of Economic Entomology, 82(5), 1299-1304. https://doi.org/10.1093/jee/82.5.1299

Kim, J., Khan, M., Lee, S. H. & Nauen, R. (2025) Understanding and managing diamide insecticide resistance in lepidopteran pests: Insights into RyR mutations and metabolic mechanisms. Pesticide Biochemistry and Physiology, 106629. https://doi.org/10.1016/j.pestbp.2025.106629.

Lai, T. & Su, J. (2011) Effects of chlorantraniliprole on development and reproduction of beet armyworm, Spodoptera exigua (Hübner). Journal of Pest Science, 84(3), 381-386. https://doi.org/10.1007/S10340-011-0366-1

Lokeshwari, D., Kumar, N., Manjunatha, H. & Shivashankar, S. (2016) Biochemical characterization of detoxifying enzymes in dimethoate-resistant strains of melon aphid, Aphis gossypii (Hemiptera: Aphididae). Advances in Entomology, 4, 167-182. doi: https://doi.org/10.4236/ae.2016.43018

Ma, X., Qu, C., Yao, J., Xia, J., Luo, C., Guedes, R. N. C. & Wang, R. (2024) Resistance monitoring of diamide insecticides and characterization of field-evolved chlorantraniliprole resistance among Chinese populations of the tomato pinworm Phthorimaea (= Tuta) absoluta (Lepidoptera: Gelechiidae). Pesticide Biochemistry and Physiology, 205, 106140. https://doi.org/10.1016/j.pestbp.2024.106140

Mani, A., Mathiyazhagan, N. & Rajinikanth, V. (2024) Neurodegenerative marine algae bioactive compounds: a viable cure to treat amyotrophic lateral sclerosis (ALS): a review. Dubai Medical Journal, 7(3), 201-217.

Matowo, J., Weetman, D., Pignatelli, P., Wright, A., Charlwood, J. D., Kaaya, R., Shirima, B., Moshi, O., Lukole, E., Mosha, J., & Manjurano, A. (2022) Expression of pyrethroid metabolizing P450 enzymes characterizes highly resistant Anopheles vector species targeted by successful deployment of PBO-treated bednets in Tanzania. PLoS One, 17(1), e0249440. https://doi.org/10.1371/journal.pone.0249440

Mohan, R., Mathiyazhagan, N. & Rajinikanth, V. (2024). Cancer region segmentation in pre-processed breast ultrasound image using VGG16 based UNet/SegNet. In 2024 9th International Conference on Communication and Electronics Systems (ICCES) (pp. 1-6). IEEE. https://doi.org/10.1109/ICCES63552.2024.10859846

Muthusamy, R. & Shivakumar, M. S. (2015). Resistance selection and molecular mechanisms of cypermethrin resistance in red hairy caterpillar (Amsacta albistriga Walker). Pesticide Biochemistry and Physiology, 117, 54-61. https://doi.org/10.1016/j.pestbp.2014.10.009

Muthusamy, R., Suganya, R., Gowri, M. & Shivakumar, M. S. (2013) Biochemical mechanisms of organophosphate and pyrethroid resistance in red hairy caterpillar Amsacta albistriga (Lepidoptera: Arctiidae). Journal of the Saudi Society of Agricultural Sciences, 12(1), 47-52. https://doi.org/10.1016/j.jssas.2012.06.002

Muthusamy, R., Vengateswari, G., Kumarasamy, S., Pandi, R., Prasannakumar, N. R., Arul, D., Dhanapal, R., Kariyanna, B. & Ramkumar, G. (2024) Combination effect of azadirachtin and chlorantraniliprole with three synergists against a serious invasive agricultural pest Spodoptera frugiperda (Lepidoptera: Noctuidae). Biocatalysis and Agricultural Biotechnology, 55, 102992. https://doi.org/10.1016/j.bcab.2023.102992

Narayanan, M. (2024) Evaluation of Antibacterial (Antibiofilm) Activity potential of ZnONPs coated on wound dressing cloth. Dubai Medical Journal, 149-159. https://doi.org/10.18502/dmj.v7i3.17731

Narayanan, M. (2025) An evaluation of antibacterial, antioxidant, and biocompatibility (hemocompatibility) nature of green synthesized ZnONPs: an in-vitro approach. Dubai Medical Journal, 1-11. https://doi.org/10.18502/dmj.v8i1.18306

Narayanan, M. & Ma, Y. (2024) Recent progress on conservation and restoration of soil fertility for horticulture. Chemosphere, 362, 142599. https://doi.org/10.1016/j.chemosphere.2024.142599

Narayanan, M. & Prabhu, N. (2025). The effect of bioactive compounds in multiple sclerosis as the adjuvant immunomodulatory: a comprehensive review. Caspian Journal of Neurological Sciences, 11(3), 185-197. https://doi.org/10.32598/CJNS.11.42.566.1

Narayanan, M. & Rajinikanth, V. (2025) Effects of bioactive compounds from marine algae on cancer-related inflammation: a review. Medical Oncology, 42(7), 250. https://doi.org/10.1007/s12032-025-02813-2.

Ong'Onge, M. A., Ajene, I. J., Runo, S., Sokame, B. M. & Khamis, F. M. (2023). Population dynamics and insecticide resistance in Tuta absoluta (Lepidoptera: Gelechiidae), an invasive pest on tomato in Kenya. Heliyon, 9(11). https://doi.org/10.1016/j.heliyon.2023.e21465

Parveen, B., Mathiyazhagan, N. & Rajinikanth, V. (2025) Empowering Patient Self-care in Plantar Hyperkeratotic/Palmoplantar Keratodermas Eczema: A Case Report. Dubai Medical Journal, 8(1), 42-47. https://doi.org/10.18502/dmj.v8i1.18311

Parveen, B., Rajinikanth, V. & Mathiyazhagan, N. (2025) Natural plant antioxidants for food preservation and emerging trends in nutraceutical applications. Discover Applied Sciences, 7(8), 845. https://doi.org/10.1007/s42452-025-07464-6

Prasannakumar, N. R., Jyothi, N., Saroja, S. & Kumar, G. R. (2021) Relative toxicity and insecticide resistance of different field population of tomato leaf miner, Tuta absoluta (Meyrick). International Journal of Tropical Insect Science, 41(2), 1397-1405. https://doi.org/10.1007/s42690-020-00334-1

Radhakrishnan, N. & Narayanan, M. (2025) Diffuse Pulmonary lesions due to invasive fungal infection in an immune-capable male: a case report. Dubai Medical Journal, 8(2), 1-8. https://doi.org/10.18502/dmj.v8i2.19003

Rajinikanth, V., Mohan, R. & Mathiyazhagan, N. (2024) Deep learning and features fusion for colorectal cancer detection from histopathology images. In 2024 9th International Conference on Communication and Electronics Systems (ICCES) (pp. 1406-1411). IEEE. https://doi.org/10.1109/ICCES63552.2024.10859542

Ramkumar, G., Muthusamy, R., Shivakumar, M. S. & Kweka, E. J. (2023) Overexpression of cytochrome P450 and esterase genes involved in permethrin resistance in larvae and adults of Culex quinquefasciatus. Parasitology Research, 122(12), 3205-3212. https://doi.org/10.1007/s00436-023-08010-2

Roditakis, E., Vasakis, E., Garcia-Vidal, L., del Rosario Martinez-Aguirre, M., Rison, J. L., Haxaire-Lutun, M. O., Nauen, R., Tsagkarakou, A,M. & Bielza, P. (2018) A four-year survey on insecticide resistance and likelihood of chemical control failure for tomato leaf miner Tuta absoluta in the European/Asian region. Journal of Pest Science, 91(1), 421-435. https://doi.org/10.1007/s10340-017-0900-x

Roditakis, E., Vasakis, E., Grispou, M., Stavrakaki, M., Nauen, R., Gravouil, M. & Bassi, A. (2015) First report of Tuta absoluta resistance to diamide insecticides. Journal of Pest Science, 88(1), 9-16. https://doi.org/10.1007/s10340-015-0643-5

Shahini, S., Bërxolli, A. & Kokojka, F. (2021) Effectiveness of bio-insecticides and mass trapping based on population fluctuations for controlling Tuta absoluta under greenhouse conditions in Albania. Heliyon, 7(1). https://doi.org/10.1016/j.heliyon.2020.e05753

Shi, Y., Wang, H., Liu, Z., Wu, S., Yang, Y., Feyereisen, R., Heckel, DG., & Wu, Y. (2018) Phylogenetic and functional characterization of ten P450 genes from the CYP6AE subfamily of Helicoverpa armigera involved in xenobiotic metabolism. Insect Biochemistry and Molecular Biology, 93, 79-91. https://doi.org/10.1016/j.ibmb.2017.12.006

Silva, J. E., Assis, C. P., Ribeiro, L. M. & Siqueira, H. A. (2016) Field-evolved resistance and cross-resistance of Brazilian Tuta absoluta (Lepidoptera: Gelechiidae) populations to diamide insecticides. Journal of Economic Entomology, 109(5), 2190-2195. https://doi.org/10.1093/jee/tow161

Sun, Y., Xu, L., Chen, Q., Qin, W., Huang, S., Jiang, Y. & Qin, H. (2018) Chlorantraniliprole resistance and its biochemical and new molecular target mechanisms in laboratory and field strains of Chilo suppressalis (Walker). Pest Management Science, 74(6), 1416-1423. https://doi.org/10.1002/ps.4824

Tarusikirwa, V. L., Machekano, H., Mutamiswa, R., Chidawanyika, F. & Nyamukondiwa, C. (2020). Tuta absoluta (Meyrick)(lepidoptera: Gelechiidae) on the “offensive” in Africa: Prospects for integrated management initiatives. Insects, 11(11), 764. https://doi.org/10.3390/insects11110764

Ullah, F., Murtaza, G., Li, X., Gul, H., Wang, Y., Zhao, S., Abbas, A.m Zhang, Z., Huang, J., Desneux, N., & Lu, Y. (2025) Selection-induced spinosad resistance and associated fitness costs in Tuta absoluta: A key invasive tomato pest. Agronomy, 15(2), 358. https://doi.org/10.3390/agronomy15020358

Venkatesan, T., Chethan, B. R. & Mani, M. (2022) Insecticide resistance and its management in the insect pests of horticultural crops. Trends in Horticultural Entomology, 455-490. https://doi.org/10.1007/978-981-19-0343-4_14

Vijayakumar, K., Maziz, M. N. H. & Mathiyazhagan, N. (2025) Classification of benign/malignant digital mammogram images using deep learning scheme. Hospital, 4, 5. https://doi.org/10.1109/ICFTS62006.2025.11031579

Wan, L., Zhou, A., Xiao, W., Zou, B., Jiang, Y., Xiao, J., Deng, C., Zhang, Y.& members of the Genefang Research Team: Huang,C., Bu, C., Zeng,j., Hao,z., Chen,Y. &  Liu, M. (2021) Cytochrome P450 monooxygenase genes in the wild silkworm, Bombyx mandarina. PeerJ, 9, e10818. https://doi.org/10.7717/peerj.10818

Xiao, Q., Deng, L., Elzaki, M. E. A., Zhu, L., Xu, Y., Han, X., Wang, C., Han, Z. & Wu, M. (2020) The inducible CYP4C71 can metabolize imidacloprid in Laodelphax striatellus (Hemiptera: Delphacidae). Journal of Economic Entomology, 113(1), 399-406. https://doi.org/10.1093/jee/toz292

Yang, T., Li, T., Feng, X., Li, M., Liu, S. & Liu, N. (2021) Multiple cytochrome P450 genes: conferring high levels of permethrin resistance in mosquitoes, Culex quinquefasciatus. Scientific Reports, 11(1), 9041. https://doi.org/10.1038/s41598-021-88121-x

Ye, M., Nayak, B., Xiong, L., Xie, C., Dong, Y., You, M., Yuchi, Z. & You, S. (2022) The role of insect cytochrome P450s in mediating insecticide resistance. Agriculture, 12(1), 53. https://doi.org/10.3390/agriculture12010053

Yin, C., Wang, R., Luo, C., Zhao, K., Wu, Q., Wang, Z. & Yang, G. (2019) Monitoring, cross-resistance, inheritance, and synergism of Plutella xylostella (Lepidoptera: Plutellidae) resistance to pyridalyl in China. Journal of Economic Entomology, 112(1), 329-334. https://doi.org/10.1093/jee/toy334

Zhang, Y. B., Li, H., Han, P., Tian, X. C., Wang, H., Geng, L., Zhang, A., Liu, W., Wan, F., Guedes, R. N. C., Desneux, N. & Zhang, G. F. (2025) Monitoring the insecticide susceptibility of a newly introduced invasive species, Tuta absoluta (Meyrick), in China. Crop Protection, 189, 107041. https://doi.org/10.1016/j.cropro.2024.107041

Zhao, X., Xu, X., Wang, X. G., Yin, Y., Li, M. Y., Wu, Y. Q., Liu, YH., Cheng, QH., Gong, CW. & Shen, L. T. (2021) Mechanisms for multiple resistances in field populations of rice stem borer, Chilo suppressalis (Lepidoptera: Crambidae) from Sichuan Province, China. Pesticide Biochemistry and Physiology, 171, 104720. https://doi.org/10.1016/j.pestbp.2020.104720

 

Citation: Muthusamy, R., Ramkumar, G., Ranjani, R., Senthil Kumar, J., Kasirajan, S. & Madhi, N. (2025) Chlorantraniliprole selection, synergism and cross-resistance to various insecticides in tomato pinworm, Tuta absoluta (Meyrick) J. Entomol. Soc. Iran, 45 (4), 499–513.

 

DOI : https://doi.org/10.22034/jesi.45.4.2

URL: https://jesi.areeo.ac.ir/article_131275.html

 

 

 

 

© 2025 by Author(s), Published by the Entomological Society of Iran

This Work is Licensed under Creative Commons Attribution-Non-Commercial 4.0 International Public License.

Biondi, A., Guedes, R. N. C., Wan, F. H. & Desneux, N. (2018) Ecology, worldwide spread, and management of the invasive South American tomato pinworm, Tuta absoluta: past, present, and future. Annual Review of Entomology, 63, 239-258. https://doi: 10.1146/annurev-ento-031616-034933
Bosch-Serra, D., Rodríguez, M. A., Avilla, J., Sarasúa, M. J. & Miarnau, X. (2021) Esterase, glutathione s-transferase and NADPH-cytochrome p450 reductase activity evaluation in Cacopsylla pyri l. (Hemiptera: psyllidae) individual adults. Insects, 12(4), 329. https://doi.org/10.3390/insects12040329
Campos, M. R., Rodrigues, A. R. S., Silva, W. M., Silva, T. B. M., Silva, V. R. F., Guedes, R. N. C. & Siqueira, H. A. A. (2014) Spinosad and the tomato borer Tuta absoluta: a bioinsecticide, an invasive pest threat, and high insecticide resistance. PloS one, 9(8), e103235. https://doi.org/10.1371/journal.pone.0103235
Domínguez, A., López, S., Bernabé, A., Guerrero, Á. & Quero, C. (2019) Influence of age, host plant and mating status in pheromone production and new insights on perception plasticity in Tuta absoluta. Insects, 10(8), 256. https://doi.org/10.3390/insects10080256
El Aimani, A., Mokrini, F., Houari, A., Laasli, S. E., Sbaghi, M., Mentag, R., Iraqi, D., Udupa, M.S., Dababat, A.A. & Lahlali, R. (2021) Potential of indigenous entomopathogenic nematodes for controlling tomato leaf miner, Tuta absoluta (Meyrick)(Lepidoptera: Gelechiidae) under laboratory and field conditions in Morocco. Physiological and Molecular Plant Pathology, 116, 101710. https://doi.org/10.1016/j.pmpp.2021.101710
Esteves, F., Rueff, J. & Kranendonk, M. (2021) The central role of cytochrome P450 in xenobiotic metabolism—a brief review on a fascinating enzyme family. Journal of Xenobiotics, 11(3), 94-114. https://doi.org/10.3390/jox11030007
Fouad, E. A., Ahmed, F. S. & Moustafa, M. A. (2022) Monitoring and biochemical impact of insecticides resistance on field populations of Spodoptera littoralis (Boisd.)(Lepidoptera: Noctuidae) in Egypt. Polish Journal of Entomology, 91(3), 109-118. https://doi.org/10.5604/01.3001.0015.9707.
Gong, P., Chen, D., Wang, C., Li, M., Li, X., Zhang, Y., Li, X. & Zhu, X. (2021) Susceptibility of four species of aphids in wheat to seven insecticides and its relationship to detoxifying enzymes. Frontiers in Physiology, 11, 623612. https://doi.org/10.3389/fphys.2020.623612
Gonzalez-Morales, M. A. & Romero, A. (2019) Effect of synergists on deltamethrin resistance in the common bed bug (Hemiptera: Cimicidae). Journal of Economic Entomology, 112(2), 786-791. https://doi.org/10.1093/jee/toy376
Hafeez, M., Li, X., Ullah, F., Zhang, Z., Zhang, J., Huang, J., Fernández-Grandon GM, Khan MM, Siddiqui, JA., Chen, L. & Ren X.Y. (2022) Down-regulation of P450 genes enhances susceptibility to indoxacarb and alters physiology and development of fall armyworm, Spodoptera frugipreda (Lepidoptera: Noctuidae). Frontiers in Physiology, 13, 884447. https://doi.org/10.3389/fphys.2022.884447
He, F., Sun, S., Tan, H., Sun, X., Qin, C., Ji, S., Li, X., Zhang, J. & Jiang, X. (2019) Chlorantraniliprole against the black cutworm Agrotis ipsilon (Lepidoptera: Noctuidae): From biochemical/physiological to demographic responses. Scientific reports, 9(1), 10328. https://doi.org/10.1038/s41598-019-46915-0
Ismail, S. M. (2021) Field persistence of certain new insecticides and their efficacy against black cutworm, Agrotis ipsilon (Hufnagel). Bulletin of the National Research Centre, 45(1), 17. https://doi.org/10.1186/s42269-020-00481-y
Kadry, S., Madhav, B., Narayanan, M. & Rajinikanth, V. (2025) Automatic farm insects detection using individual/fused efficientnet features. In International Conference on Data Engineering and Communication Technology (pp. 151-159). Singapore: Springer Nature Singapore. https://doi.org/10.1007/978-981-96-5223-5_13
Kadry, S., Prudhvi, M. N., Narayanan, M. & Rajinikanth, V. (2025). Automatic desert/mountain detection from satellite image using deep transfer learning. In International Conference on Data Engineering and Communication Technology (pp. 161-169). Singapore: Springer Nature Singapore. https://doi.org/10.1007/978-981-96-5223-5_14
Kao, C. H., Hung, C. F. & Sun, C. N. (1989) Parathion and methyl parathion resistance in diamondback moth (Lepidoptera: Plutellidae) larvae. Journal of Economic Entomology, 82(5), 1299-1304. https://doi.org/10.1093/jee/82.5.1299
Kim, J., Khan, M., Lee, S. H. & Nauen, R. (2025) Understanding and managing diamide insecticide resistance in lepidopteran pests: Insights into RyR mutations and metabolic mechanisms. Pesticide Biochemistry and Physiology, 106629. https://doi.org/10.1016/j.pestbp.2025.106629.
Lai, T. & Su, J. (2011) Effects of chlorantraniliprole on development and reproduction of beet armyworm, Spodoptera exigua (Hübner). Journal of Pest Science, 84(3), 381-386. https://doi.org/10.1007/S10340-011-0366-1
Lokeshwari, D., Kumar, N., Manjunatha, H. & Shivashankar, S. (2016) Biochemical characterization of detoxifying enzymes in dimethoate-resistant strains of melon aphid, Aphis gossypii (Hemiptera: Aphididae). Advances in Entomology, 4, 167-182. doi: https://doi.org/10.4236/ae.2016.43018
Ma, X., Qu, C., Yao, J., Xia, J., Luo, C., Guedes, R. N. C. & Wang, R. (2024) Resistance monitoring of diamide insecticides and characterization of field-evolved chlorantraniliprole resistance among Chinese populations of the tomato pinworm Phthorimaea (= Tuta) absoluta (Lepidoptera: Gelechiidae). Pesticide Biochemistry and Physiology, 205, 106140. https://doi.org/10.1016/j.pestbp.2024.106140
Mani, A., Mathiyazhagan, N. & Rajinikanth, V. (2024) Neurodegenerative marine algae bioactive compounds: a viable cure to treat amyotrophic lateral sclerosis (ALS): a review. Dubai Medical Journal, 7(3), 201-217.
Matowo, J., Weetman, D., Pignatelli, P., Wright, A., Charlwood, J. D., Kaaya, R., Shirima, B., Moshi, O., Lukole, E., Mosha, J., & Manjurano, A. (2022) Expression of pyrethroid metabolizing P450 enzymes characterizes highly resistant Anopheles vector species targeted by successful deployment of PBO-treated bednets in Tanzania. PLoS One, 17(1), e0249440. https://doi.org/10.1371/journal.pone.0249440
Mohan, R., Mathiyazhagan, N. & Rajinikanth, V. (2024). Cancer region segmentation in pre-processed breast ultrasound image using VGG16 based UNet/SegNet. In 2024 9th International Conference on Communication and Electronics Systems (ICCES) (pp. 1-6). IEEE. https://doi.org/10.1109/ICCES63552.2024.10859846
Muthusamy, R. & Shivakumar, M. S. (2015). Resistance selection and molecular mechanisms of cypermethrin resistance in red hairy caterpillar (Amsacta albistriga Walker). Pesticide Biochemistry and Physiology, 117, 54-61. https://doi.org/10.1016/j.pestbp.2014.10.009
Muthusamy, R., Suganya, R., Gowri, M. & Shivakumar, M. S. (2013) Biochemical mechanisms of organophosphate and pyrethroid resistance in red hairy caterpillar Amsacta albistriga (Lepidoptera: Arctiidae). Journal of the Saudi Society of Agricultural Sciences, 12(1), 47-52. https://doi.org/10.1016/j.jssas.2012.06.002
Muthusamy, R., Vengateswari, G., Kumarasamy, S., Pandi, R., Prasannakumar, N. R., Arul, D., Dhanapal, R., Kariyanna, B. & Ramkumar, G. (2024) Combination effect of azadirachtin and chlorantraniliprole with three synergists against a serious invasive agricultural pest Spodoptera frugiperda (Lepidoptera: Noctuidae). Biocatalysis and Agricultural Biotechnology, 55, 102992. https://doi.org/10.1016/j.bcab.2023.102992
Narayanan, M. (2024) Evaluation of Antibacterial (Antibiofilm) Activity potential of ZnONPs coated on wound dressing cloth. Dubai Medical Journal, 149-159. https://doi.org/10.18502/dmj.v7i3.17731
Narayanan, M. (2025) An evaluation of antibacterial, antioxidant, and biocompatibility (hemocompatibility) nature of green synthesized ZnONPs: an in-vitro approach. Dubai Medical Journal, 1-11. https://doi.org/10.18502/dmj.v8i1.18306
Narayanan, M. & Ma, Y. (2024) Recent progress on conservation and restoration of soil fertility for horticulture. Chemosphere, 362, 142599. https://doi.org/10.1016/j.chemosphere.2024.142599
Narayanan, M. & Prabhu, N. (2025). The effect of bioactive compounds in multiple sclerosis as the adjuvant immunomodulatory: a comprehensive review. Caspian Journal of Neurological Sciences, 11(3), 185-197. https://doi.org/10.32598/CJNS.11.42.566.1
Narayanan, M. & Rajinikanth, V. (2025) Effects of bioactive compounds from marine algae on cancer-related inflammation: a review. Medical Oncology, 42(7), 250. https://doi.org/10.1007/s12032-025-02813-2.
Ong'Onge, M. A., Ajene, I. J., Runo, S., Sokame, B. M. & Khamis, F. M. (2023). Population dynamics and insecticide resistance in Tuta absoluta (Lepidoptera: Gelechiidae), an invasive pest on tomato in Kenya. Heliyon, 9(11). https://doi.org/10.1016/j.heliyon.2023.e21465
Parveen, B., Mathiyazhagan, N. & Rajinikanth, V. (2025) Empowering Patient Self-care in Plantar Hyperkeratotic/Palmoplantar Keratodermas Eczema: A Case Report. Dubai Medical Journal, 8(1), 42-47. https://doi.org/10.18502/dmj.v8i1.18311
Parveen, B., Rajinikanth, V. & Mathiyazhagan, N. (2025) Natural plant antioxidants for food preservation and emerging trends in nutraceutical applications. Discover Applied Sciences, 7(8), 845. https://doi.org/10.1007/s42452-025-07464-6
Prasannakumar, N. R., Jyothi, N., Saroja, S. & Kumar, G. R. (2021) Relative toxicity and insecticide resistance of different field population of tomato leaf miner, Tuta absoluta (Meyrick). International Journal of Tropical Insect Science, 41(2), 1397-1405. https://doi.org/10.1007/s42690-020-00334-1
Radhakrishnan, N. & Narayanan, M. (2025) Diffuse Pulmonary lesions due to invasive fungal infection in an immune-capable male: a case report. Dubai Medical Journal, 8(2), 1-8. https://doi.org/10.18502/dmj.v8i2.19003
Rajinikanth, V., Mohan, R. & Mathiyazhagan, N. (2024) Deep learning and features fusion for colorectal cancer detection from histopathology images. In 2024 9th International Conference on Communication and Electronics Systems (ICCES) (pp. 1406-1411). IEEE. https://doi.org/10.1109/ICCES63552.2024.10859542
Ramkumar, G., Muthusamy, R., Shivakumar, M. S. & Kweka, E. J. (2023) Overexpression of cytochrome P450 and esterase genes involved in permethrin resistance in larvae and adults of Culex quinquefasciatus. Parasitology Research, 122(12), 3205-3212. https://doi.org/10.1007/s00436-023-08010-2
Roditakis, E., Vasakis, E., Garcia-Vidal, L., del Rosario Martinez-Aguirre, M., Rison, J. L., Haxaire-Lutun, M. O., Nauen, R., Tsagkarakou, A,M. & Bielza, P. (2018) A four-year survey on insecticide resistance and likelihood of chemical control failure for tomato leaf miner Tuta absoluta in the European/Asian region. Journal of Pest Science, 91(1), 421-435. https://doi.org/10.1007/s10340-017-0900-x
Roditakis, E., Vasakis, E., Grispou, M., Stavrakaki, M., Nauen, R., Gravouil, M. & Bassi, A. (2015) First report of Tuta absoluta resistance to diamide insecticides. Journal of Pest Science, 88(1), 9-16. https://doi.org/10.1007/s10340-015-0643-5
Shahini, S., Bërxolli, A. & Kokojka, F. (2021) Effectiveness of bio-insecticides and mass trapping based on population fluctuations for controlling Tuta absoluta under greenhouse conditions in Albania. Heliyon, 7(1). https://doi.org/10.1016/j.heliyon.2020.e05753
Shi, Y., Wang, H., Liu, Z., Wu, S., Yang, Y., Feyereisen, R., Heckel, DG., & Wu, Y. (2018) Phylogenetic and functional characterization of ten P450 genes from the CYP6AE subfamily of Helicoverpa armigera involved in xenobiotic metabolism. Insect Biochemistry and Molecular Biology, 93, 79-91. https://doi.org/10.1016/j.ibmb.2017.12.006
Silva, J. E., Assis, C. P., Ribeiro, L. M. & Siqueira, H. A. (2016) Field-evolved resistance and cross-resistance of Brazilian Tuta absoluta (Lepidoptera: Gelechiidae) populations to diamide insecticides. Journal of Economic Entomology, 109(5), 2190-2195. https://doi.org/10.1093/jee/tow161
Sun, Y., Xu, L., Chen, Q., Qin, W., Huang, S., Jiang, Y. & Qin, H. (2018) Chlorantraniliprole resistance and its biochemical and new molecular target mechanisms in laboratory and field strains of Chilo suppressalis (Walker). Pest Management Science, 74(6), 1416-1423. https://doi.org/10.1002/ps.4824
Tarusikirwa, V. L., Machekano, H., Mutamiswa, R., Chidawanyika, F. & Nyamukondiwa, C. (2020). Tuta absoluta (Meyrick)(lepidoptera: Gelechiidae) on the “offensive” in Africa: Prospects for integrated management initiatives. Insects, 11(11), 764. https://doi.org/10.3390/insects11110764
Ullah, F., Murtaza, G., Li, X., Gul, H., Wang, Y., Zhao, S., Abbas, A.m Zhang, Z., Huang, J., Desneux, N., & Lu, Y. (2025) Selection-induced spinosad resistance and associated fitness costs in Tuta absoluta: A key invasive tomato pest. Agronomy, 15(2), 358. https://doi.org/10.3390/agronomy15020358
Venkatesan, T., Chethan, B. R. & Mani, M. (2022) Insecticide resistance and its management in the insect pests of horticultural crops. Trends in Horticultural Entomology, 455-490. https://doi.org/10.1007/978-981-19-0343-4_14
Vijayakumar, K., Maziz, M. N. H. & Mathiyazhagan, N. (2025) Classification of benign/malignant digital mammogram images using deep learning scheme. Hospital, 4, 5. https://doi.org/10.1109/ICFTS62006.2025.11031579
Wan, L., Zhou, A., Xiao, W., Zou, B., Jiang, Y., Xiao, J., Deng, C., Zhang, Y.& members of the Genefang Research Team: Huang,C., Bu, C., Zeng,j., Hao,z., Chen,Y. &  Liu, M. (2021) Cytochrome P450 monooxygenase genes in the wild silkworm, Bombyx mandarina. PeerJ, 9, e10818. https://doi.org/10.7717/peerj.10818
Xiao, Q., Deng, L., Elzaki, M. E. A., Zhu, L., Xu, Y., Han, X., Wang, C., Han, Z. & Wu, M. (2020) The inducible CYP4C71 can metabolize imidacloprid in Laodelphax striatellus (Hemiptera: Delphacidae). Journal of Economic Entomology, 113(1), 399-406. https://doi.org/10.1093/jee/toz292
Yang, T., Li, T., Feng, X., Li, M., Liu, S. & Liu, N. (2021) Multiple cytochrome P450 genes: conferring high levels of permethrin resistance in mosquitoes, Culex quinquefasciatus. Scientific Reports, 11(1), 9041. https://doi.org/10.1038/s41598-021-88121-x
Ye, M., Nayak, B., Xiong, L., Xie, C., Dong, Y., You, M., Yuchi, Z. & You, S. (2022) The role of insect cytochrome P450s in mediating insecticide resistance. Agriculture, 12(1), 53. https://doi.org/10.3390/agriculture12010053
Yin, C., Wang, R., Luo, C., Zhao, K., Wu, Q., Wang, Z. & Yang, G. (2019) Monitoring, cross-resistance, inheritance, and synergism of Plutella xylostella (Lepidoptera: Plutellidae) resistance to pyridalyl in China. Journal of Economic Entomology, 112(1), 329-334. https://doi.org/10.1093/jee/toy334
Zhang, Y. B., Li, H., Han, P., Tian, X. C., Wang, H., Geng, L., Zhang, A., Liu, W., Wan, F., Guedes, R. N. C., Desneux, N. & Zhang, G. F. (2025) Monitoring the insecticide susceptibility of a newly introduced invasive species, Tuta absoluta (Meyrick), in China. Crop Protection, 189, 107041. https://doi.org/10.1016/j.cropro.2024.107041
Zhao, X., Xu, X., Wang, X. G., Yin, Y., Li, M. Y., Wu, Y. Q., Liu, YH., Cheng, QH., Gong, CW. & Shen, L. T. (2021) Mechanisms for multiple resistances in field populations of rice stem borer, Chilo suppressalis (Lepidoptera: Crambidae) from Sichuan Province, China. Pesticide Biochemistry and Physiology, 171, 104720. https://doi.org/10.1016/j.pestbp.2020.104720
CAPTCHA Image